EST details — SGN-E288946
| Search information |
| Request: 288946 | Match: SGN-E288946 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C76247 | Clone name: cLES-17-G24 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C190571 [TUS-60-M1] | Trace: SGN-T341338 | EST: SGN-E540463 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E288946 | Length: 220 bp (876 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E288946 [] (trimmed)
GTCTTTATTTCAGCGTCTGTTGTTTTCTCAAAATAATGGACTTATACGTCCAAACTTGTGTCTGTTGGGATTTGCAACGTCTGTGTGCAATTTCT
CAACTAGCCTTGCCTTTTGGTGTTCCACCAGAAGCCTTTTATGTCTCTGCACTTTGAATAGGGTCATGTTGCCCGTTACTGCCCCTGTTGCGTCT
ATTGATAAAAGAGAGTTTGCTGTGCGTCAC
CAACTAGCCTTGCCTTTTGGTGTTCCACCAGAAGCCTTTTATGTCTCTGCACTTTGAATAGGGTCATGTTGCCCGTTACTGCCCCTGTTGCGTCT
ATTGATAAAAGAGAGTTTGCTGTGCGTCAC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E288946] | SGN-U592166 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T101388 [Download][View] | Facility Assigned ID: TPSCN48TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.941 | Expected Error Rate: 0.0304 | Quality Trim Threshold: 12.5 |
Working
