EST details — SGN-E288454

Search information 
Request: 288454Match: SGN-E288454
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76100Clone name: cLES-16-N8
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190544 [TUS-60-K22] Trace: SGN-T341292 EST: SGN-E540417 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C190544 [TUS-60-K22] Trace: SGN-T349256 EST: SGN-E548381 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288454Length: 475 bp (921 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288454 [] (trimmed) CACGCTCCGACGAATCGGACCTAATCGCACAATCTCAAATCTCTCTGAATTGCTACAGATTTTGAAGGTCCTCACTTGGTTCGTCAATGGAAGCG
ATACGAAAGCAAGCTACAAGGCTCAGGGAACAGGTCGCTCGCCAACAGCAAGCTGTTCTCAAGCAGTTCGGGGCTGGGGGGTATGGTTCAGATCT
TGTGACTGATGAAGCTGAGATGCAGCAGCATCATAAGCTCGAAAGGCTTTACATATCCACTCGTGCTGCAAAGCACTTTCAAAGGGATATTGTCC
GTGGTGTTGAAGGCTATATTGTTACTGGGTCTAAACAAGTTGAAATAGGAACTAAACTGTCAGAAGATAGTAGGAAATATGGCGCTGAAAATACA
TGTACAAGTGGTACTACATTGTCAAAAGCTGCATTAGGTTTTTCACGTGCTCGTGCTCAGATGGAGAAGGAGCGAGGGAATCTATTGAAAGCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288454] SGN-U583730 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101180 [Download][View] Facility Assigned ID: TPSCL76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5