Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E287466

Search information 
Request: 287466Match: SGN-E287466
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C79606Clone name: cLES-9-I17
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190333 [TUS-60-C3] Trace: SGN-T340927 EST: SGN-E540052 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E287466Length: 222 bp (628 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E287466 [] (trimmed) CTTTGCCACAAACTTTGTTCCCGGCAAATGAATATCATAAAATGTTCTCTAGATATTATTGTTTGATGGCTTTGTAAAGTTTTAGTTGTGAGTTT
ACTTGACAATAGAATGATTTTTTCTTAGTCCTGAATTTCATTTGATGAATGAAATACTGCAAAATTCATATTGAAGGGGAAAATTGATGACGAAG
CAAAATTAACAAGACCAGAGTTAAATTTGAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E287466] SGN-U580483 Tomato 200607 Build 2 81 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99285 [Download][View] Facility Assigned ID: TPSBG57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5