EST details — SGN-E286462

Search information 
Request: 286462Match: SGN-E286462
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75110Clone name: cLES-12-O17
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190418 [TUS-60-F16] Trace: SGN-T341073 EST: SGN-E540198 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190418 [TUS-60-F16] Trace: SGN-T341076 EST: SGN-E540201 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286462Length: 382 bp (736 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286462 [] (trimmed) TGAAATTAAGGCTTTGGCATAATGAGGAACTAGACGAAGATGTTGCTGACGTGCCGCATTTACTTCCACCGTGTATCTATTCTACTGCTATCTGA
ACATCTCATCATCTGAGTATTGGTGTTTAAGGCTCCATTTTAATTCGGAGCTTGGAGAACTACGTTTTGAATATTTGATTGGTGTAATTGAGAAA
AGAAGTTGAATGTTCAAAGATTGTGAAAAAGAAGTTGTGAAACACTTTAGCTTTTTGCCTTTTGGTTTGTTTTATGGAAACAAAAACAATGTGTA
TATGGTTTTAGGAGCAACTGTTGTGGCATTTATATATGTGGAATACGAACCAATTGTTGTCTGAATAGCAACATTCATTAATTTGCTGGACTAAA
CT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286462] SGN-U579973 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T99993 [Download][View] Facility Assigned ID: TPSBS93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0090 Quality Trim Threshold: 12.5