Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E285203

Search information 
Request: 285203Match: SGN-E285203
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72583Clone name: cLER-20-J23
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190080 [TUS-59-H14] Trace: SGN-T340493 EST: SGN-E539618 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190080 [TUS-59-H14] Trace: SGN-T340495 EST: SGN-E539620 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285203Length: 512 bp (847 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285203 [] (trimmed) CTTGTATTGAGAAGTGGCTGGAAGCTGGACATAGCACTTGTCCCAAGACTCAACAAGCCCTCACAAGCAAATCTCTGACACCCAACTATGTGTTG
CGTAGCCTTATAGCACAGTGGTGTGAAGCGAATGGGATTGAACCACCTAAAAGACCAGGTAGTGCTCCACCTAAAAAGTCTGCATCTGCATGCAC
TCCTGCTGAGCACTCGATGATAGAGAATCTCCTGAGAAAGCTCAAATCTGGCAGCCCCGAAGAGGCACGTTCTGCTGCAGGTGAAATCCGCCTTC
TTGCTAAGCGTAATACTGATAATCGTGTTGCAATAGCTGAAGCTGGTGCCATTCCTCTGCTAGTCCATCTTCTATCCACACCAGATTCTCGAACT
CAAGAGCATGCTGTTACAGCACTTCTCAACCTTTCCATATGTGAGAATAATAAAGGACACATCGTAACTTCAGGGGCAGTGCCTGGTATTGTTCA
TGTACTCAGGAAGGGGAGCATGGAAGCACGTGAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285203] SGN-U582844 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T96775 [Download][View] Facility Assigned ID: TPRDA60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5