Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E284567

Search information 
Request: 284567Match: SGN-E284567
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77839Clone name: cLES-3-H12
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190176 [TUS-59-L14] Trace: SGN-T340660 EST: SGN-E539785 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C190176 [TUS-59-L14] Trace: SGN-T349152 EST: SGN-E548277 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284567Length: 257 bp (732 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E284567 [] (trimmed) CAGCTTAAAATGCTTATTATCCTCTTTAAATTTCAATTTTTAAACCAAATTTAGTCCAACAGGGGGGCTTGTTTGAACTATTCCACTAACTCATC
ACAAATGGGAAGCTAGCAGATCACCCAAGAGTTGGGGTCCTTTTCCACACTGTAATAGGGCTGATAAGCAGGAACAGGGGTTGGGCACTGGGGAT
AAGGTGGTTGATTTTGATATTGATAGAGAACCGGAGCTGGATATGCCTTTATCGCTGCCGGTTTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284567] SGN-U595114 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97588 [Download][View] Facility Assigned ID: TPSAL42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.861 Expected Error Rate: 0.0244 Quality Trim Threshold: 14.5