Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E283982

Search information 
Request: 283982Match: SGN-E283982
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70022Clone name: cLER-13-F16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C186001 is on microarray TOM1: SGN-S1-1-2.2.7.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186001 [TUS-48-N15] Trace: SGN-T192570 EST: SGN-E391244 Direction: 5' Facility: INRA
Clone: SGN-C186001 [TUS-48-N15] Trace: SGN-T192813 EST: SGN-E391487 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283982Length: 379 bp (922 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283982 [] (trimmed) ACACAATCATTGGAAATTTTGAATATTGAAAAAAAATAATCCATTCTAATGTCAAGTAATTACTGACAACTACTTTACAAGGCCATCAAACAATC
AAATTTTAAGAATGTTTAAGATTTTCATTTTCCGGGAACAAAGTTTGTGGCGAAAGCCCAAGCGTTGTTGTTAACGGGGTCTGCAAGGTGGTCAG
CAAGGTTTTCCAATGGACCCTTTCCGGTAACAATGGCTTGAACGAAGAATCCAAACATCGAGAACATAGCAAGTCTGCCGTTCTTAATCTCCTTT
ACCTTGAGCTCGGCAAATTTGTATCTTCCTCTTTCACTCTCCCAATTTCTCTTTAGCTCAGCTACAATGGCTTCCACATTATCCACAATTACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283982] SGN-U592777 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94676 [Download][View] Facility Assigned ID: TPRBZ32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0192 Quality Trim Threshold: 14.5