EST details — SGN-E283762

Search information 
Request: 283762Match: SGN-E283762
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77071Clone name: cLES-1-K23
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C77071 [cLES-1-K23] Trace: SGN-T97439 EST: SGN-E283763 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283762Length: 327 bp (845 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283762 [] (trimmed) TTTTCTTGAAGATCTCTTTGCTGCAGCAATTTTCCATTTTCTTTCAATTGCTTCATCCATTTCTATCTGTTCTTGTCTGCATTCTTGGCTACAAA
ATGGTGTATCCCCTCTGTACATGAAGATGTCATGGTTGTGAGCTAAGGTTCTCTGGCCAAGAGAACAAGTATCAAGAAAATGGGGTTGGTAATTT
TCTTCACACCCAGTGTAGTATAGTGCCCCACATCCATTTCGTTATCCACTCTTCACTTGCTTCTTCAAAAAAAAAAGCAACATTCTTGAGACAAA
AAAGATTCTTGCTTTGAGGAATTGGTTGCAAAAATGGCGACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283762] SGN-U587873 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97438 [Download][View] Facility Assigned ID: TPSAA72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0095 Quality Trim Threshold: 14.5