EST details — SGN-E283576

Search information 
Request: 283576Match: SGN-E283576
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76925Clone name: cLES-1-A17
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76925 [cLES-1-A17] Trace: SGN-T97253 EST: SGN-E283577 Direction: 3' Facility: TIGR
Clone: SGN-C190096 [TUS-59-I6] Trace: SGN-T340520 EST: SGN-E539645 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190096 [TUS-59-I6] Trace: SGN-T340523 EST: SGN-E539648 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283576Length: 229 bp (882 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283576 [] (trimmed) CAATGATAGAGTGTTCCGTTGTAACAAAGTTCTTCTATCCAAATTCTTCTTTATGTTAAGTTGAATCTTTTGATATAAATTAACGATCTTAGAGC
TCGCAGCAGCAACTGGTTCAACAGTGAAGTTTCTTCCTGGTTTTCAGGGACAACTTCCTTTTGAACTTGAAACTGGGTATGTTGGAGTTGGTGAT
TCAAAAAATGTGCAATTATTCTATTATTTCATAGAGTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283576] SGN-U585996 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97252 [Download][View] Facility Assigned ID: TPSAA09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5