Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E280949

Search information 
Request: 280949Match: SGN-E280949
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74009Clone name: cLER-7-G7
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189776 [TUS-58-K22] Trace: SGN-T339970 EST: SGN-E539095 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189776 [TUS-58-K22] Trace: SGN-T339973 EST: SGN-E539098 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280949Length: 435 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280949 [] (trimmed) AGTGATCGAGAGGCAAAAGAGGATTGCAGAAAGAAGTGCAGCTAAGGGTTCGTCCCCAGCAGCTTCCAAGAAAGGGCCAGCAGGAAGTAAAACAG
CTTCAAAGATCTCACCTTCATCCAAACTTCACACATTTCCAGTGCAGGTCAAGCATTAAGGAGCAATCCATCAAGGAAAAGTATGATCCGACCTT
AAAATATATTTGATTGCTTTGCCGCGAATATGGAACATCCACAATTCACTGCTTTGTGCACATTGGATTATCCACAAATATATCTTGGAGAAATA
AAATATTTTCGATGAAAATTATAGATTTTTTTCTTTACTAGGACAGCTCTGCTTGCTGGCTTGATGCAAGTTATTCCTTCTCATTTATTTAGACA
TTCATGTCCCATCATAAGGTTTTGCCAGTATAGTTGCTTGAGGCTTTATTATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280949] SGN-U571158 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93412 [Download][View] Facility Assigned ID: TPRAY40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0014 Quality Trim Threshold: 12.5