EST details — SGN-E279425

Search information 
Request: 279425Match: SGN-E279425
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69511Clone name: cLER-11-B13
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279425Length: 290 bp (852 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E279425 [] (trimmed) CAGGTTTAAAGAAGCTGCTGATAAAATTCAGGGACCTTTAAGACAAATCTTTGTTGAATTCTTGGAGAGATCTTGCACTGCTGAGTTCTCTGGTT
TCCTTCTCTACAAGGAACTTGGAAGGAGGCTCAAGAAAACTAATCCTGTTGTTGCAGAGATTTTCTCCCTCATGTCTAGGGATGAAGCTCGCCAT
GCTGGGTTTTTGAACAAGGGTTTATCTGACTTCAATTTGGTTTGAAGAAAGTGTATTTTCTTGCTTTGGTCAAGAACCCCAAGTCCAAGGGGGCC
CGGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279425] SGN-U595616 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94177 [Download][View] Facility Assigned ID: TPRBQ07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5