Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E273483

Search information 
Request: 273483Match: SGN-E273483
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C68121Clone name: cLEN-3-D14
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273483Length: 315 bp (1062 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E273483 [] (trimmed) CTCATTATCTCCTTCGTTCCCCAGTTTATCGCCCTTTGCAACTTCACTCACCCATCCAAATCAAATGTTCAGCTTCCAAGGATTGTTCCAACAGA
GAGGAAAGTTCAACTCAGTTTAAGCAACTTAGGAATGTTGCTTGTGGATTCCTTGCTGATAGGGCACTATCTTCTGTTTCTCCCGTTATTGCTGC
TGGTCAGAGATTACCTCCATTATCAACAGATCCAGATAGGTGAGAACGGGCCTTAGTTGGCAACACAATAGGTCAAGCCAATGGTGTTGGCAGAA
AGCCACTAGATCTGCGCTTTTGTGATTACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273483] SGN-U568326 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88079 [Download][View] Facility Assigned ID: TRRAL19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0292 Quality Trim Threshold: 14.5