EST details — SGN-E273241
| Search information |
| Request: 273241 | Match: SGN-E273241 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C63255 | Clone name: cLEM-24-O11 |
| ||
| Library Name: cLEM | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit
Development Stage: immature green fruit
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C189454 [TUS-57-N12] | Trace: SGN-T339430 | EST: SGN-E538555 | Direction: 5' | Facility: INRA (MWG) |
| Clone: SGN-C189454 [TUS-57-N12] | Trace: SGN-T348950 | EST: SGN-E548075 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E273241 | Length: 157 bp (1154 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E273241 [] (trimmed)
GTTTTGCAGAGACTCAACTCGCGACCTTTGAACTCGCTATCGGTGATCTCTTTCTCCGGCGAAGTATTTCGGATTTAAGATCTGCTAGCTATAAC
AATGGCCTCTTCATATCTACCTGCAACCACAGATTCGCTAGCTCAAGCTTCTGAAGCTACAA
AATGGCCTCTTCATATCTACCTGCAACCACAGATTCGCTAGCTCAAGCTTCTGAAGCTACAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E273241] | SGN-U571876 | Tomato 200607 | Build 2 | 48 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T87447 [Download][View] | Facility Assigned ID: TGFDO90TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.953 | Expected Error Rate: 0.0261 | Quality Trim Threshold: 14.5 |
Working
