EST details — SGN-E270436

Search information 
Request: 270436Match: SGN-E270436
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62116Clone name: cLEM-1-I16
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189277 [TUS-57-G3] Trace: SGN-T339163 EST: SGN-E538288 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270436Length: 382 bp (707 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270436 [] (trimmed) AATGACTTACCAAAGCCATGGTTTCTTCTGAACAAGGCATCTCCATTGAATGCTGCACAATATGCAACTTACACTAAACTTGTTGCTGATCAAAA
TGCACTCACCACACAGCTCCATACCTTTTGCTCTTCAGCAAATCTCATGTGTGCACCAGATCTGTCACCAAGTCTTGAAAAACACAGTGGAGATA
TCCATTTTGCCACTTACAGTGACAAAAACTTTACCAATTATGGAACCAATGAACCTGGAATTGGAGTTAACACTTTCAAGAACTACTCTGAAGGA
GAAAACATCCCTGTAAATTCTTTCAAGCGATATGGTAGAGGTTCTCCCCGTGACAATAAATTTGACAATTACGCCTCTGATGGCAATGTTATTGA
CC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270436] SGN-U586540 Tomato 200607 Build 2 101 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83809 [Download][View] Facility Assigned ID: TGFAB56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0294 Quality Trim Threshold: 14.5