EST details — SGN-E269346
| Search information |
| Request: 269346 | Match: SGN-E269346 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C61546 | Clone name: cLEM-18-E18 |
| ||
| Library Name: cLEM | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit
Development Stage: immature green fruit
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C189375 [TUS-57-K5] | Trace: SGN-T339310 | EST: SGN-E538435 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E269346 | Length: 191 bp (707 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E269346 [] (trimmed)
TCTGTTTCTCAACTTTCTGCTGTGAAAGAGCAAGAGATGCTTCACATTCCAGGTGGCCAATGCGGTTACCAAATCGGATCCAAGTTCTGAGAAGT
TGTGTGTGCGGAGCATGGGATTGATTCAACCGGAAGGTACCAGGGAGACACATATCTACAACTTGAGAGGGTGAATGTGTATTACAATGAAGCTA
G
TGTGTGTGCGGAGCATGGGATTGATTCAACCGGAAGGTACCAGGGAGACACATATCTACAACTTGAGAGGGTGAATGTGTATTACAATGAAGCTA
G
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E269346] | SGN-U586652 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T86142 [Download][View] | Facility Assigned ID: TGFCR33TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.970 | Expected Error Rate: 0.0335 | Quality Trim Threshold: 14.5 |


