EST details — SGN-E269346

Search information 
Request: 269346Match: SGN-E269346
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61546Clone name: cLEM-18-E18
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189375 [TUS-57-K5] Trace: SGN-T339310 EST: SGN-E538435 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E269346Length: 191 bp (707 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E269346 [] (trimmed) TCTGTTTCTCAACTTTCTGCTGTGAAAGAGCAAGAGATGCTTCACATTCCAGGTGGCCAATGCGGTTACCAAATCGGATCCAAGTTCTGAGAAGT
TGTGTGTGCGGAGCATGGGATTGATTCAACCGGAAGGTACCAGGGAGACACATATCTACAACTTGAGAGGGTGAATGTGTATTACAATGAAGCTA
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E269346] SGN-U586652 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T86142 [Download][View] Facility Assigned ID: TGFCR33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0335 Quality Trim Threshold: 14.5