Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E267309

Search information 
Request: 267309Match: SGN-E267309
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C47703Clone name: cLEI-17-G3
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E267309Length: 430 bp (972 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E267309 [] (trimmed) CCATGCTATCAAAAAATCAAAGATTTTTTCTGAAATGAAAAATACAGTAACATTAGTTGACACTTCCTGGTAGCAGATAATCATGCACTCTCCAA
TATAAAATTACTCCTACAGAGACTAGAAATCGCACAAGGAAAACACAACATTTTTGCAACCCTGCATACTAGCATATGGTTTTGCGCAGCCAAGG
TTTAGCGAAGCTTTCTTTTTTTCTCTTCCACCTCCAAAGATTCTAAGGCAATATGGGTAAGGAAAAGATTCACATCAGTATTGGGGTCATTGGTC
ATGTCGACTCTGGAAAGTCTACTACCACTGGTCACTTGATCTACAAGCTTGGTGGTATTGACAAGCGTGTTATTGAGAGGTTCGAGAAGGAAGCT
GCTGAAATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E267309] SGN-U578520 Tomato 200607 Build 2 144 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T83491 [Download][View] Facility Assigned ID: TGSCM38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5