EST details — SGN-E266425

Search information 
Request: 266425Match: SGN-E266425
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48196Clone name: cLEI-3-L17
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188793 [TUS-56-B23] Trace: SGN-T338365 EST: SGN-E537490 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188793 [TUS-56-B23] Trace: SGN-T338368 EST: SGN-E537493 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E266425Length: 570 bp (682 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E266425 [] (trimmed) GTGATAGCCATTTTCATTGTTGAAGAAAGCTAAAGAAGAGCCATGGATTTGGCTTCCATAATCCATAACAACACTACTCAATCCCCTCCAAAGTT
CCACAAGATTTCCCCAATCTCTTCGCCTTCTTCATCCCCCAAATGGGTTCACTTTCAATTAGCTCATCTTCGCTTTCCACCACCCATTTCAGTTG
GGTGTAAATGTAGAGGAAGAAGATATAGTGCGGTGGTTTCCTGCTTGAGAAAATCTGAACAAGGGGAAGAGTTGTCTAATGCTGAAGAAAGAACT
CAAGGGTCTGGAACTTATGTGTCTTCTGTCAAGACAGTAGCCTTGTGTGTGTTTTCAGCAGTGGCATTTGGTGTTGGCGTGGGACTCACGGATGG
AGTCAGCAAGTCATCTGAATTTTTCGCTGGGTATCTGCTGGAGCAGAGTTTGTCAGTGGATAATCTATTTGTATTCGTTCTGATATTCAAATATT
TCAAAGTACCACTTATGTATCAGAAACCGGGTGCTATCGTATGGAATAGCTGGTGCCATAATCTTCAGGTTGTCTATCATACTGCTTGGAACAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E266425] SGN-U584301 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80113 [Download][View] Facility Assigned ID: TGSAK69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5