EST details — SGN-E265940

Search information 
Request: 265940Match: SGN-E265940
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48970Clone name: cLEI-6-I23
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188906 [TUS-56-G16] Trace: SGN-T338558 EST: SGN-E537683 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C188906 [TUS-56-G16] Trace: SGN-T338561 EST: SGN-E537686 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E265940Length: 348 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E265940 [] (trimmed) GTTTTTACCTAATCTATTTCTCCTCATAGACCACAGGCATGGATGAAGCATCGGTGCTCGTGGCCCTTTAAGTTGGAAAAGAATTACTTAAACGA
ATGACATAATTTGCATTTCTTGTATACTTAAAAAACCTGCACCTTAAATTGCCAAAGGTGATAAAATGTTATGATGAAACATCATAACTCTTGCA
TTCAATATGTGCTGGTAAAACCAACTTTCGGATTTATCCGAGCTCAACAGCTTGAGAGTTGAGTATTACAAGTTGAAGCTAGTAAAGATGTATTA
AGGCATTCTGGAACAGTGATACGAAGCATAAGAAGCTACTTATAAGTGGAAAACAATCACCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E265940] SGN-U585716 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T80726 [Download][View] Facility Assigned ID: TGSAU60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0343 Quality Trim Threshold: 14.5