EST details — SGN-E260361

Search information 
Request: 260361Match: SGN-E260361
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C40436Clone name: cLEG-53-N3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
See unigene SGN-U586445 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E260361Length: 172 bp (898 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E260361 [] (trimmed) TGCTATTGTAGCTGGTTGTAATTGTAACCTCATGTTCAGCTTATTCTCTGTTTTACTTGCTATGTAAATATGCGTGTGCATTTTTCAATATATTT
CAACAACTTCCAAGGACGAACAGTAGTAATTCACTTTTTTAGAGTAATAAAAGGTGACTAATGTTCATTTGGTTCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E260361] SGN-U586445 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T75057 [Download][View] Facility Assigned ID: TBFIC74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.893 Expected Error Rate: 0.0033 Quality Trim Threshold: 12.5