EST details — SGN-E252614

Search information 
Request: 252614Match: SGN-E252614
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32564Clone name: cLEG-20-F5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180669 is on microarray TOM1: SGN-S1-1-6.4.19.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180669 [TUS-34-P11] Trace: SGN-T187107 EST: SGN-E375205 Direction: 3' Facility: INRA
Clone: SGN-C180669 [TUS-34-P11] Trace: SGN-T187108 EST: SGN-E375206 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252614Length: 538 bp (914 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E252614 [] (trimmed) GTGAAATTTGCTTAAGCTCTTCAAGCAGTAGAGTTATTGCTTGGTTGCGAGATAAATAACTTTTTCTCACGTTGTTGTAATCTGATTTCACTTTT
GCTTGAGAAAGATTAGTGAAAACGGTTGAAAATTCTGTGTGACAGGTCGTGGTTTTACTCCCTTGAGCAATGAGGTTACCAGGTAAACTGCTTGT
GCTATTTTTTGTGTTTTCTTACTCTTTGTTCTTACTTCGAGTGTGTCAAGGGACCTGGACCGTTGACTGATATTGGACGCAAGTATTCTAACAAG
TAGTAATTGTTTTTTCTTACTCACCTATAAAGGGGAACGGTAGCAGAATCATCTGAGCCTGCTATGAATTCTTGATATTTTGTTGATAGAAAAAT
GTGTTTGAGCTTATCAATTCCTTTGAAGCCGGTAGCTAGTATGACTAAGTCGGATTTTATTGTTTCGGCCTGACCATCGAGCACAATACCTTCTT
TAGAAAATCCAAAGCAGTCTGCTTTCTTGATAAGCTTTATACTTTCCTCCTCAACTCTGTCGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252614] SGN-U579664 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67464 [Download][View] Facility Assigned ID: TBFDA27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0153 Quality Trim Threshold: 14.5