Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E250450

Search information 
Request: 250450Match: SGN-E250450
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32291Clone name: cLEG-18-E15
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188097 [TUS-54-E23] Trace: SGN-T351780 EST: SGN-E550905 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E250450Length: 269 bp (844 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E250450 [] (trimmed) AAACAAGATGTGGTGAGGTGTCTCGCCTGAGGCTTTTGGGGGATCAAGTGCACTCTACCCGTATTGCTTTTGTTGAATTTGTTATGGCTGAGAGT
GCAATTTTGGCGTTGGACTGTTGCGGACAGATTTTGGGATCCCGACGCATCAGGGTGAGTTCTTCAAAGACACCTGTGAGGCCACGAGTTCCTCT
CCCCATGATGCATTATGCAATCCTTTGTTGCTATCAAGGTCTGGAAAGAGTTGAGCGCACGCCCTCTTGGATGACTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E250450] SGN-U579216 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67224 [Download][View] Facility Assigned ID: TBFCQ32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0277 Quality Trim Threshold: 14.5