Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E249636

Search information 
Request: 249636Match: SGN-E249636
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C30224Clone name: cLEF-56-O20
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249636Length: 544 bp (762 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E249636 [] (trimmed) GTAATGTGGATGAAGCGTTGAGGTTACAGAGAATTATGGAGGATGAAGGACATGAGCCTGATGCAAATGCTTACAATATTATTGCTACTGGCCTG
CGTAAGCTAGATTTGCATGACGTGGCGAAGAGGTTGTTGCTGTCGATGGTGGATCGAGGTGTAGCTCCAAATGTATTGGCTTATACGTCTTTGAT
TGATATTTACTGCAAGCAGGGAGATTTTGTTCAAGCGAAAAGGACACTTAGAGAGATGGAAACTAAGGGAATTAAGCCTAGCACGGGAACATACA
ATGCCCTGGTAGATGGTTACTTCAAGCATGGATATTTTATTGACGCAAAAAGGGCACTTATTGAGATAGAAACTAAAGGAGTTAAGCCTAACACG
ACAACATATACTGTGTTGATAGATGGTTATTCTAAGCAAGGAGATTTTGTTAGAGCTAAAAAGACACTTATTGAGATGGAGAATAACGGAGTTAA
GCCTAACACCAATACATACACTGCACTGATAGATGGTTATTGCCAGAAAGGTATGATGAATGAAGCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249636] SGN-U603847 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T63765 [Download][View] Facility Assigned ID: TMGIN94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0048 Quality Trim Threshold: 20.5