EST details — SGN-E246178

Search information 
Request: 246178Match: SGN-E246178
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26533Clone name: cLEF-40-L23
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246178Length: 365 bp (889 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E246178 [] (trimmed) GTTTCTTGGTCCTCAAGTCGAGAGGTCACTCGGATATCAGAAATCAGTTCAGATCTTTGAGCTTAAGCGCCATGGCGACCGAAGAAGACGCCGTC
CGACGCCGTACTGCACTCGCCGATTATCGGAAAAAGCTCCTTCAGCACAAGGAGCTTGATGCTCGGGTTCGGACAGTGAGAGAGAACTTGCGGGC
TACCAAAAAGGAATATGCTAAAACAGAAGATGATTTGAAGTCACTTCAAAGTGTTGGACAGATCATAGGAGAAGTGCTCCGACCTCTAGATAATG
AGCGTTTGATAGTAAAAGCTAGCAGTGGTCCGAGGTATGTAGTTGGCTGTCGCAGTAAAGTGGACTATGTTGAGAAAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246178] SGN-U566414 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60030 [Download][View] Facility Assigned ID: TMGGC72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0217 Quality Trim Threshold: 14.5