Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E245858

Search information 
Request: 245858Match: SGN-E245858
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C29486Clone name: cLEF-51-M19
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E245858Length: 358 bp (908 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E245858 [] (trimmed) TAACAGCTGATCAACGAATTGACTGAGACACTATATTGAAGAACACATTTTCCCTAGATTTCGAAGAGAGAAAGAACGGAAGAAGCAATAATCGA
TGTAATCAAATCTCAACAAATATCTTCGAGGTCGATTGGGAAGGTCATAGTTCACTCACTTGTGCTTTTGAGCATCGTAGACCACTATAATAGAG
TCGCAAAAGACAGAAGAATGTTGTTGCGATTTTGCTTTGAACTTCATTTAAAGGTCTTTGAAGCAGCTATTGCAGCCAGGGCGAAAGAAGTAGCA
GTCTTTGCATCAACTTCGGAGTCTTTCACAAAGTCAAAAATTAATTGCACCAATAAGGAGAGCCTTGTTAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E245858] SGN-U579105 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62997 [Download][View] Facility Assigned ID: TMGHS82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0123 Quality Trim Threshold: 14.5