EST details — SGN-E245235

Search information 
Request: 245235Match: SGN-E245235
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C27527Clone name: cLEF-44-F3
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E245235Length: 463 bp (897 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E245235 [] (trimmed) ATATCCAATGGAACCGTCACAACATAATCAGATGGACATACCATTCTGATGAAATATTTAGTTAACTATGTCCATCAAATGAACAATGCACTTCC
AGTGGTTCGCAAAATGAAGAATCAGATCAATGACATTACTCAACACGGAGGTTTCACCGATAGAAATGAGCTTCTTGATCAGTCAGTTGATTACG
CATCTGATTCAATTGCCCCAATTGATAAAAGAAGTCAATCGGAGCATGCCAATGCGCAAAGATGGCTAAGTGGTGTGCTTACTAACCACGTTACG
TGCTTGGATGAGCTTGATTCCTTTACTAAAGCTATGATAAATGGAACGAATCTTGAAGAGTTGATCTCGAGAGCTAAGGTAGCATTAGCGATGCT
TGCGTCTTTGACAACTCAGGATGAGGATGTTTTCATGACGGTTTTAGGAAAAATGCCATCTTGGGTGAGTTCGATGGATAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E245235] SGN-U595465 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61096 [Download][View] Facility Assigned ID: TMGGS26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0286 Quality Trim Threshold: 14.5