EST details — SGN-E244923
| Search information |
| Request: 244923 | Match: SGN-E244923 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C25928 | Clone name: cLEF-2-E23 |
| ||
| Library Name: cLEF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: mature green
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E244923 | Length: 205 bp (972 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E244923 [] (trimmed)
CACCAAAAGCCAAAGATGGTTGTTCTGTGGAGCCAATTGGTCATTAAATCAGTGCTTTTAGTCTGTAAGCATTATTGCTCTCTGCTTATATAGGG
GCAGAGCAGAGGTTAAAGTAGAAAATACTAGTTTGGAAAAGAAAGGGGCTGTAAGCAATAGCAAGTGCAATTTGTTTCAAGGTAGATGGGCAATT
GATCCTTCTTAACCA
GCAGAGCAGAGGTTAAAGTAGAAAATACTAGTTTGGAAAAGAAAGGGGCTGTAAGCAATAGCAAGTGCAATTTGTTTCAAGGTAGATGGGCAATT
GATCCTTCTTAACCA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E244923] | SGN-U571214 | Tomato 200607 | Build 2 | 120 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T59206 [Download][View] | Facility Assigned ID: TMGAE36TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.935 | Expected Error Rate: 0.0249 | Quality Trim Threshold: 14.5 |


