EST details — SGN-E244255
| Search information |
| Request: 244255 | Match: SGN-E244255 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C26156 | Clone name: cLEF-37-O13 |
| ||
| Library Name: cLEF | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: mature green
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C169725 [TUS-6-H11] | Trace: SGN-T350690 | EST: SGN-E549815 | Direction: 5' | Facility: Avesthagen |
| Sequence |
| Sequence Id: SGN-E244255 | Length: 294 bp (834 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E244255 [] (trimmed)
TAGGGAAGGGAAGGCTAAGATTGTGCCCGGCGTACTCTTCATTGACGACTTACATATGCTTGACATTGAGTGTTCACTCTTTCCTAAACCGAGCT
CTGGAGAATGACATGGCACCTATATTGGTTGTTGCTACAAATAGAGGCATTACTACAATACGGGGAACAAACTACACATCCCCACACGGGATTCC
AATTGACTTTCTTGATCGCCTGCTGATCATCTGTACACAACCTTACAAAGAGGAAGAAATTCGCAAAATCCTGGACATCATATGCCAAGAGGAGG
ATGTAGAAA
CTGGAGAATGACATGGCACCTATATTGGTTGTTGCTACAAATAGAGGCATTACTACAATACGGGGAACAAACTACACATCCCCACACGGGATTCC
AATTGACTTTCTTGATCGCCTGCTGATCATCTGTACACAACCTTACAAAGAGGAAGAAATTCGCAAAATCCTGGACATCATATGCCAAGAGGAGG
ATGTAGAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E244255] | SGN-U567663 | Tomato 200607 | Build 2 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T59845 [Download][View] | Facility Assigned ID: TMGFO91TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.982 | Expected Error Rate: 0.0312 | Quality Trim Threshold: 14.5 |


