EST details — SGN-E244255

Search information 
Request: 244255Match: SGN-E244255
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26156Clone name: cLEF-37-O13
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169725 [TUS-6-H11] Trace: SGN-T350690 EST: SGN-E549815 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E244255Length: 294 bp (834 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E244255 [] (trimmed) TAGGGAAGGGAAGGCTAAGATTGTGCCCGGCGTACTCTTCATTGACGACTTACATATGCTTGACATTGAGTGTTCACTCTTTCCTAAACCGAGCT
CTGGAGAATGACATGGCACCTATATTGGTTGTTGCTACAAATAGAGGCATTACTACAATACGGGGAACAAACTACACATCCCCACACGGGATTCC
AATTGACTTTCTTGATCGCCTGCTGATCATCTGTACACAACCTTACAAAGAGGAAGAAATTCGCAAAATCCTGGACATCATATGCCAAGAGGAGG
ATGTAGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E244255] SGN-U567663 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T59845 [Download][View] Facility Assigned ID: TMGFO91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0312 Quality Trim Threshold: 14.5