Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E243263

Search information 
Request: 243263Match: SGN-E243263
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C25308Clone name: cLEE-2-N16
cartOrder Clone
Library Name: cLEEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: seeds and maturing carpels
Development Stage: 5 days post-anthesis to fruit over-ripe stage

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E243263Length: 486 bp (851 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E243263 [] (trimmed) AAGTCTTCAACCTGTTTGTGGGCAAGAAGCACTTGATCTCCTAAATTGCACCACTGAATCGCCTTACGATAAGGAGAAATGCCAAAAGTTGCTTG
AAACTTTGCGCCAATGCGTAATCAACAAGAAAGTAAAGAAGTTCTCGCTTTCTGATCCGAGGATAGGGAAACCAGAAGGGAGCAATGAGAAAAGA
AGTTAATCCTTGTGAAGTCATAAGGAATGTCTTCTGTGTTGTGAATTTGCTCCTGATTCTTCTTATTCGGCGGAATAAGCATTTACCATCTTATT
CTAACATGTACAATTGTCCTAAACATCTCATTTCTGTTTCCTACACTTGTTAGTTTTCTCTTTTTCAGCTATTACTTCGAAATCATGAAAATTTT
ACATGGATTATGTGAAATCTATTAAGACATATATGTGGAGTATAACACTAAATCAGGTTAGTTTACCATGTCTTGTATTCATGACTTGTATGAGT
ATTTTGATTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E243263] SGN-U601617 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T58826 [Download][View] Facility Assigned ID: TSEAH80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0096 Quality Trim Threshold: 12.5