EST details — SGN-E241462

Search information 
Request: 241462Match: SGN-E241462
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C19907Clone name: cLED-28-I21
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241462Length: 312 bp (727 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E241462 [] (trimmed) GTCGATTCGCTGAAGATGATGAATCATTAATTCTTTGTCTTGATCAAGGTGTTACTTATATCAAAGCAAAGGTCAATTGTACCCTTGATGATTTA
CTTCAACAGACAAAAAAAGACCTTGATCTAGCCTTGTCATTTTGGCCTCAAGGTACGATGGATGTTGATGACTATAATTTGTTCGTCACGCCACT
CATGGTTGTGCATGTCACGACATTTGAATGTGGAGGCCTAACCCTAGATATTAACATTGCACATCCTGTTATGGACGGATGCACCACATTCAAAA
TACTATTTGAATGGGCCAAGGGGAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241462] SGN-U570129 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T55940 [Download][View] Facility Assigned ID: TOVEE59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0350 Quality Trim Threshold: 14.5