EST details — SGN-E239874

Search information 
Request: 239874Match: SGN-E239874
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C20150Clone name: cLED-29-H24
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184346 is on microarray TOM1: SGN-S1-1-1.1.16.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184346 [TUS-44-I16] Trace: SGN-T198182 EST: SGN-E396856 Direction: 3' Facility: INRA
Clone: SGN-C184346 [TUS-44-I16] Trace: SGN-T198183 EST: SGN-E396857 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239874Length: 237 bp (367 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239874 [] (trimmed) CAGAGACGCTGACTCCACAAACGGTGTAGAAGCAGAGTCGAAAAATACTACTATTACTAATAATAACAACAATAAGCTTCCTTCTTCAAAGTTCA
AAGGTGTTGTCCCTCAACCAAATGGTCGATGGGGTGCACAAATCTACGAAAAACATCAAAGGATTTGGCTTGGTACGTTCAATGGCGAAGAAGAA
GCAGCAAGAGCTTATGATATCGCGGCACAGAGATTCCGTGGTAGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239874] SGN-U599510 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56162 [Download][View] Facility Assigned ID: TOVEL48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5