Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E239722

Search information 
Request: 239722Match: SGN-E239722
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21379Clone name: cLED-33-G23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184430 is on microarray TOM1: SGN-S1-1-5.1.16.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184430 [TUS-44-M4] Trace: SGN-T1828 EST: SGN-E378632 Direction: 5' Facility: Giov. Lab
Clone: SGN-C184430 [TUS-44-M4] Trace: SGN-T198205 EST: SGN-E396879 Direction: 3' Facility: INRA
Clone: SGN-C184430 [TUS-44-M4] Trace: SGN-T199964 EST: SGN-E398638 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239722Length: 391 bp (705 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239722 [] (trimmed) TTCACACACAAACAGAAAAAGCTAAAAGGACTGAAATATGAGAAAAGAGGGAAAATTTGATCCTAGGGTTTACTATTTACGGTAAAAAATGGATG
GTTCAGCTCCGCAAACGGATACTGTGATGTCGTATGCGGCGGCAGGACAGCAACCTGCTATGCCGCCGCTGCCGATGGCCGGAATGGAGAATATT
CCTGCAACGTTGAGTCACGGTGGCCGGTTTATTCAATACAATATTTTTGGTAATATATTTGAAGTTACTGCGAAGTATATGCCTCCAATTATGCC
AATCGGTAAAGGAGCTTATGGTATTGCTGGACCTGCTTTGAATTCCGAGACGAATGAGCATGGTGCAATTAAGAAGATTGCAGATGCTTTTGATA
ACAAAATTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239722] SGN-U596801 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T56995 [Download][View] Facility Assigned ID: TOVEY48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0297 Quality Trim Threshold: 14.5