EST details — SGN-E239645

Search information 
Request: 239645Match: SGN-E239645
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C18586Clone name: cLED-23-P18
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169243 [TUS-5-D9] Trace: SGN-T351043 EST: SGN-E550168 Direction: 5' Facility: Avesthagen
Clone: SGN-C169243 [TUS-5-D9] Trace: SGN-T351293 EST: SGN-E550418 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239645Length: 401 bp (1047 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239645 [] (trimmed) CAGGAACAATGGGCTAAGTAACCCTTTTTCTCAAAATGAGTCAATGACTTCATTAGAGAGAGTTCTTAAAAACTCAGCAGAAGGAAAAGAAGCTA
GTCCAAACGGAAGTGAAATCAACAATAGAAGAGAGGTAATAGTACGAGGGGTACTTTCTGTTACTGTGGTATCAGCTGATGATCTGCCCCCAGCT
GATATAGGGGGGAAGGCTGACCCCTACGTCGTTCTGATCATGAAGAAGGCTCAAATCAAGAACAAAACCAGGGTTGTAAATGAAAGTCTAAACCC
TGTATGGAATCAAACTTTTGACTTTGTTGTTGAGGATGGATTACATGATATGCTTATGCTGGAAGTCTGGGACCATGACACATTCGGAAAGGATT
TCATGGGAAGATGCATACTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239645] SGN-U585893 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54610 [Download][View] Facility Assigned ID: TOVDN93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5