Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E237959

Search information 
Request: 237959Match: SGN-E237959
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C17185Clone name: cLED-18-O8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184162 is on microarray TOM1: SGN-S1-1-1.1.16.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237959Length: 330 bp (870 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237959 [] (trimmed) CCAAGAAGGACAAGAAGAAGCATAAGCGAAGCTCAAATAAATCATCCTCAAAGAAGGAAGCTGGAGAAGTTAAAACCAAGAAAACTCCTTCAAAT
TCATCAAAAAGCTCAAAGAAAAATGATAACAACGATGCAAATTCAGAAGTGCATTCAAAGAAGAAAACTACTGAAGTAGTTAAGGGAAATTCATC
TACACCAAAAAAACCTAGTTCAAAAGACAAAACTGGGAAAAAAGATCCGAATGGGAAGGGCCATAAGAAAGCGAATAAATTGAAGCCAAGTGATG
ATGAACTCAGAAGTGCAATTTGTGAAGTTCTAAAAGAAGTTGACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237959] SGN-U576784 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53262 [Download][View] Facility Assigned ID: TOVCR88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0299 Quality Trim Threshold: 14.5