| SGN ID: SGN-C23147 | Clone name: cLED-4-J8 |  | Order Clone |
|
| Library Name: cLED | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis
Microarray: Alias clone
SGN-C174514 is on microarray TOM1: SGN-S1-1-1.3.15.3
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E231760 | Length: 239 bp (760 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E231760 [] (trimmed)
ACTATGACTTAAACAAGAAAGAATAGATTTTCCTATGGCTACTCAAACTTGATCAATTTATAATTTTATTAATTATATTCTTTTGGGGGGGGGTA
TTCACACGAGTTGGTACCGTTAAGAAGAAGAAGAGAAAAAAAAAAAACTGATTAAGTTTCCAACTTCCATCATAACATGGGGAACAACCTTTTTG
AGCAATGTCATTGATTTGAAGTCCAATATCATAAACCCCCCCATTTTTC
[BLAST] [AA Translate]
| SGN-ID: SGN-T49529 [Download][View] |
Facility Assigned ID: TOVAP52TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.916 |
Expected Error Rate: 0.0288 |
Quality Trim Threshold: 14.5 |
