Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E218355

Search information 
Request: 218355Match: SGN-E218355
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C52951Clone name: cLEL-18-E1
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E218355Length: 194 bp (588 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E218355 [] (trimmed) AGCTGGACTCAGAAATATGCAATGGGATGATGCGCAAAATTGTCTCCAGGCATGTCTGGGACTTTTGTAACAGCAATGTCTTATTGTGCTTGGGG
TGAATGAATAAATTCCGTGAAAGAACTTAGTTACTTCTTAATCTCCCTTCATGAGGGTTGTTAAGGTAACAGCTTGTTTCAATTTGTGAATATCT
ATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E218355] SGN-U592075 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T7787 [Download][View] Facility Assigned ID: cC-esflcLEL18E01d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0262 Quality Trim Threshold: 14.5