EST details — SGN-E209806

Search information 
Request: 209806Match: SGN-E209806
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C8596Clone name: cLEC-52-H18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186704 [TUS-50-K22] Trace: SGN-T351656 EST: SGN-E550781 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E209806Length: 376 bp (915 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E209806 [] (trimmed) TTCTTGTGCCACGGTTGGAACTGAATGGTTGAATCCTGTAAGTACCACATTACCTTTGCCTGGAAGAAATAATCATTTCAGGGGAAAATGCGAAT
TGAGTAGAAGGGGTTTTACTTTTAATGGTATAGTTGCTGCTGGAGCTTCAGTTATGACCACTTCTGTAGTGGCTGAACCCTCTAAAGGTTTGGAG
AGATTGCCATTTAAGCCAGAGGGGTATAACTATTGGACGTGGCGCGGCCATAAAATTCATTATGTAGTGGAAGGAGAAGGATTTCCAGTTGTTCT
AATTCATGGATTTGGTGCTTCTGCCTTTCACTGGAGGTGTAACATACCCGAACTGGCTAAAAAATACAAGGTTTATGCTCTAGATTTGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E209806] SGN-U566347 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T32615 [Download][View] Facility Assigned ID: TCAHZ45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5