EST details — SGN-E208650

Search information 
Request: 208650Match: SGN-E208650
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7599Clone name: cLEC-39-I24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168671 [TUS-3-L13] Trace: SGN-T746 EST: SGN-E379958 Direction: 5' Facility: Avesthagen
Clone: SGN-C168671 [TUS-3-L13] Trace: SGN-T1056 EST: SGN-E379897 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208650Length: 350 bp (1084 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208650 [] (trimmed) TAAAATTCCATATTTATCTGCAAACAACAAAACCCCTAATTTAAAGGGGTTGCGGATTGTGTGATATTTTCTCCTTTCTTGTTGGTGTCGTCAAT
TTCTTGAAACATGGCGGGTCAAACAAACACAAAAGACTCGGACGTGAATGAAGAATTGCAGGAGCTCCAATTCACGAAAAGGGGTTGTTGCTTTT
GGTTTCCATCTTTCACATGTGGAAGAAGCGTTTGGGAACCAGTCTCTACCAGCGATCAAAAGGAAGAAACGCATTGGTGGGATAAGGGGGTAAAC
GTTGTTATGAAAGTCACGGAGTGGTCGGAACTTGTGGCAGGTCCAAAATGGAAGACATTTATTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208650] SGN-U564794 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31940 [Download][View] Facility Assigned ID: TCAFX60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0285 Quality Trim Threshold: 14.5