EST details — SGN-E206848

Search information 
Request: 206848Match: SGN-E206848
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5862Clone name: cLEC-33-G12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183203 is on microarray TOM1: SGN-S1-1-8.2.3.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T195182 EST: SGN-E393856 Direction: 3' Facility: INRA
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T195629 EST: SGN-E394303 Direction: 5' Facility: INRA
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T195629 EST: SGN-E398866 Direction: 5' Facility: INRA
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T199546 EST: SGN-E398220 Direction: 5' Facility: INRA
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T199592 EST: SGN-E398266 Direction: 3' Facility: INRA
Clone: SGN-C183203 [TUS-41-J1] Trace: SGN-T199592 EST: SGN-E398865 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206848Length: 543 bp (770 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E206848 [] (trimmed) CCGAACCGAAAAACCGAATGCCCACCCCTAATCAAACAGTGATAATTCTTTACGCTCACATACTAACACGTATAATTATACCCCTAAATTTTATA
ACAAAGAACTGGAATTGGCTTTATGACTTAGCAAAGATATTAGGTGGATCAGGGGTGTCAAAAATGAGCCCAAATATAGGTAACTTGTTCGACCT
GTTTAGAATTTTAAGGATTGGGCTTTAAGATAATTTGAATTGGGTTCAGTCTCAACCCATTTAAGCATAACCCATTCGAAGAGAATCCTCAATTA
AATCTAATTCAATCTCCAATTTCAATCCGTTTTAAAAATTTTTATTACGATATCTTCCTATATTTAAGGGATGAATTATTATCTATTTAATATCT
TTTAGAATTTATCTATCAATTTGTTAATTTTTTTAAAAAAGATTCTTGAACTAAAATTCAAATTATGATTATAAAAATTAAATATCAATAAGTTA
AATTATTGAAATTAATCGGGTCAAATTGGGCGGGTCAAGACCTAACCCGTTTTTAGCTCATTTGAGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206848] SGN-U593763 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30120 [Download][View] Facility Assigned ID: TCAEZ42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.914 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5