EST details — SGN-E205686

Search information 
Request: 205686Match: SGN-E205686
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3771Clone name: cLEC-21-M5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205686Length: 419 bp (924 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E205686 [] (trimmed) ATTTACTCTCCTCTTTGCAAGAACTAATTTTGGATGGAAATGTGCTGATTGGTACAATTCCTAAGGAGATTGGCCTATTGAAAAACCTGAAGGTC
TTGGATTTGGGTGCTAACCAGCTAACAGGACCAATTCCTTCCGAGCTTGGAAATTTGACAAAAATTATGAAAATCAACCTACAATCTAATGGATT
AACAGGGAAATTGCCTGCTGAGCTTGGTAATTTGAAATACCTTGAGGAACTTCGGTTGGACAGGAACAAACTCCAAGGACTAGTGCCTGCTAATA
CTGGATCAGATTTTACATCCGCTGTACGTGGAATGTATGCCTCTGGTGCCAGCGCTACAGGTTTTTGTCGCACATTCCAACTCAAAGTGGCTGAT
TTCTCATATAACTTTCTTATTGGAAGCATACCAAAGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205686] SGN-U601159 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28009 [Download][View] Facility Assigned ID: TCADC75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5