Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E203453

Search information 
Request: 203453Match: SGN-E203453
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2353Clone name: cLEC-15-K7
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183910 is on microarray TOM1: SGN-S1-1-5.3.19.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183910 [TUS-43-G12] Trace: SGN-T196878 EST: SGN-E395552 Direction: 3' Facility: INRA
Clone: SGN-C183910 [TUS-43-G12] Trace: SGN-T196879 EST: SGN-E395553 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203453Length: 438 bp (937 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203453 [] (trimmed) GGGAAGAGAAGGCACCCCATATTGAATCCTAGCCAGGACATGAGGTATCGTGGTTCAGCAGAACCTCCTTTATTACCTAGAGTGCCTCAGAAACC
ACCCATACTGCCCATGCCACCACATGGTGGATGGTTGGTGGAAGATGACCTAAATAAAGGACACATGGGTGGTCGATCACCTGGAATTTTTCAAG
AATCTGATGCATCAAGGTATGCTAAACAGAGAGGTCATCAGAATTTTCTGAGTCAAGGTGCAACAAACATGATGTTACCATCATATGCATCTGCA
GGGAAGAACGGGGAGGTAAATTTCAGGCATGAAATGCATAGACTTATTCATCAGACAGAGGGTAGATTCTCTCAACATCAGTCGTTATTTAACAA
CAGAGAATCTCAACTAGAAGCTGGGAGAATGAACATCTTGCCATCTTTAGCTACTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203453] SGN-U601725 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26554 [Download][View] Facility Assigned ID: TCACE64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5