Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E203311

Search information 
Request: 203311Match: SGN-E203311
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C448Clone name: cLEB-3-H5
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C448 [cLEB-3-H5] Trace: SGN-T23058 EST: SGN-E203312 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203311Length: 549 bp (804 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203311 [] (trimmed) ATTAATTTCTTCTCATATTTATCAACATTTCACTTTTTAGATTGCTGTTGGAGTCTGCTATATCATATTGATGCTTTGAAATGGGTAAGAAGGGA
AATTGGTTTTCATCGGTGAAAAAGGCGCTTGGTTCGGGTAACAAAAAGAAAGATAAGAAACAGAAATCAGAGAAATGGTCCGAAAAGCAACAGAA
CGACGAGTTGGATTCTTTGAATGCAGAAACTGCATTAGTGTGTCCGGGACCTCCTACTCCTCCGCAGGTAGAGCAGATGAAATTGATGGAAGCAG
AGAATGAGCAGAACAAGCATGCGTATTCGGTAGCTATTGCCACTGCTGTTGCTGCAGAAGCAGCTGTTGCTGCTGCTCAAGCTGCTGCTGAGGTT
GTTCGCCTCACAGCTGCAGCCTGTAGCTCGGGTCAATCAAAGGAAGAGATTGCAGCTATAAGAATACAAACAGTTTTTCGAGGATACTTGGCTAG
GAGAGCATTGAAGGCGTTGAGAGGATTAGTGAAGTTGAAGGCAATGATTCAAGGTCAATCTGTGAAACGACAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203311] SGN-U603215 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23057 [Download][View] Facility Assigned ID: TSHAK39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5