EST details — SGN-E200112
| Search information |
| Request: 200112 | Match: SGN-E200112 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C601 | Clone name: cLEB-7-D15 |
| ||
| Library Name: cLEB | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E200112 | Length: 317 bp (1083 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E200112 [] (trimmed)
CAATCTCCACCTCTTTCTCTCTCTCTTTCTACCACACCCTCTTCTTTCTCAACCCTTTTCAACTTGAATTAAAAAAAAATCCCTGCTTTTTCCCC
CACCTAAATCCCCATTTCAAGATTCTTGATTTTCAACTACTTTTCCTCTTGTAGTTTTAATGCATAATTTGGTGAGCTATGGTGAGCATCCGAAG
GCGCATGCTGTTATGACTTTGCTCTGGACGGAGCGCCTTCTTGGTTCCACTGCCAAAATTCTCTGAGATTGGGCACTTCGCTGAACATTATTTCT
TTATCAACAGACCCACTATTGTACACCCAATG
CACCTAAATCCCCATTTCAAGATTCTTGATTTTCAACTACTTTTCCTCTTGTAGTTTTAATGCATAATTTGGTGAGCTATGGTGAGCATCCGAAG
GCGCATGCTGTTATGACTTTGCTCTGGACGGAGCGCCTTCTTGGTTCCACTGCCAAAATTCTCTGAGATTGGGCACTTCGCTGAACATTATTTCT
TTATCAACAGACCCACTATTGTACACCCAATG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E200112] | SGN-U571523 | Tomato 200607 | Build 2 | 12 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T22684 [Download][View] | Facility Assigned ID: TSHBA20TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.938 | Expected Error Rate: 0.0244 | Quality Trim Threshold: 14.5 |
Working
