EST details — SGN-E1179263
| Search information |
| Request: 1179263 | Match: SGN-E1179263 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C910152 | Clone name: Nt04-D11 |
| ||
| Library Name: Sam_NtLeaf | Organism: Nicotiana tabacum |
Tissue: leaf
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E1179263 | Length: 284 bp (284 bp untrimmed) |
| Status: Current Version | Direction: Unknown |
>SGN-E1179263 [] (trimmed)
GTACACTTTGGGAGCAACATGGAACCTTAGTGCAAGACACTTCGTGCTTGAGTCATCACATCCTATCTTCTTTAACCGCATCAGAAAAGAAGAAA
ACAAGCGAGAAAATCGCTTGGCCTATGGCATCTTTCCTATGTTTTATTTATCATTTGTTCTATTTTAACTCTTCTATGATTGCTATGTTGAAATT
CACACTCAGAATAGGATTATTAGTAAAGTTTTACTTAATCACCTTAGGTTCTTTCCTCTATCTCATTATAGAAGTAATTGTTTTATCACAAAAA
ACAAGCGAGAAAATCGCTTGGCCTATGGCATCTTTCCTATGTTTTATTTATCATTTGTTCTATTTTAACTCTTCTATGATTGCTATGTTGAAATT
CACACTCAGAATAGGATTATTAGTAAAGTTTTACTTAATCACCTTAGGTTCTTTCCTCTATCTCATTATAGAAGTAATTGTTTTATCACAAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E1179263] | SGN-U455909 | Nicotiana tabacum | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T909934 [Download][View] | Facility Assigned ID: AJ632881 |
| Submitter: None | Sequencing Facility: |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |
Working
