EST details — SGN-E1144653
Search information |
Request: 1144653 | Match: SGN-E1144653 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C873027 | Clone name: tbt_003295 |
| ||
Library Name: Nt_Mix1 | Organism: Nicotiana tabacum |
Tissue: Mixed
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E1144653 | Length: 152 bp (152 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E1144653 [] (trimmed)
GGGCATTAAGTGCACTGAGGCCAAGCTTATACTCCTGGTAGATTTCATTGGCNTGGAGTAGTTGGTTGGGCTCCACTAGGCTATCCCTTTTTCTC
TTGGTCTCTGAAATCCATTATTTTAAGTATTTTTCATTAGAAATGTTTATTTTGAGC
TTGGTCTCTGAAATCCATTATTTTAAGTATTTTTCATTAGAAATGTTTATTTTGAGC
Unigenes |
Current Unigene builds | |||||
[SGN-E1144653] | SGN-U465980 | Nicotiana tabacum | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T875227 [Download][View] | Facility Assigned ID: CV017677 |
Submitter: None | Sequencing Facility: |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |