EST details — SGN-E1142183
Search information |
Request: 1142183 | Match: SGN-E1142183 |
Request From: web user | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C878004 | Clone name: tbt_002971 |
| ||
Library Name: Nt_Mix1 | Organism: Nicotiana tabacum |
Tissue: Mixed
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E1142183 | Length: 144 bp (144 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E1142183 [] (trimmed)
AGCGGGACCGCATTGTTAAGTAGCTTCATTTTCCGATTCAGCTCGCTTTCCCATGGCTGCTCCTCCACCATTACGATGGCTGAGGCCCGAGGTGT
ATCCACTATTTGCAGCGGTGGGAGTACTGTTGGAATTTGTGGGTTTCAA
ATCCACTATTTGCAGCGGTGGGAGTACTGTTGGAATTTGTGGGTTTCAA
Unigenes |
Current Unigene builds | |||||
[SGN-E1142183] | SGN-U455453 | Nicotiana tabacum | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T872711 [Download][View] | Facility Assigned ID: CV019098 |
Submitter: None | Sequencing Facility: |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |