EST details — SGN-E1098961

Search information 
Request: 1098961Match: SGN-E1098961
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C831780Clone name: BY26262
nocartOrdering Not Available
Library Name: MAT005Organism: Nicotiana tabacum

Tissue: Unknown
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1098961Length: 327 bp (327 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1098961 [] (trimmed) ATGGCTATAAACCGAGGCTTGAGGCTGGTTTGAATCGCCGATTGAGGGAGTTCGTCTGAGGTTTCGTCCCCGATCGAGGTCCGTTCATGGTTGCT
AGTTCTTGCTTCTCGGCCGCTGTCGCTTCAGATTTCCATTGCAAGACTTACTTTCATTTGATTCTAGTGAATTTAATTAAAGAGTTTACATTCTC
AGGTCTTATTCTCTCGTTCTTTTAATGTTTGATGTTTGATTTTTGTGTGGCTAAATATGACTTGAGCCTTAATTAATTGGTATTTTGGAATATAT
AGCTCATTTGATTCTTAATCAAGTACTAATCAATGTTGCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1098961] SGN-U472486 Nicotiana tabacum Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T829530 [Download][View] Facility Assigned ID: BP532096
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: