EST details — SGN-C88343

Search information 
Request: 88343Match: SGN-C88343
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C88343Clone name: cLET-7-N8
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182007 is on microarray TOM1: SGN-S1-1-4.4.10.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182007 [TUS-38-H5] Trace: SGN-T194703 EST: SGN-E393377 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291904Length: 280 bp (580 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E291904 [] (trimmed) CCCCCGGCTGAGGTTTTTAACATTATATCTAAAATATGTTTTAAATTTATCAACATTGCTTTTCTTATTTCAATACTAATGAGTATCCAATTACT
AGCCTCAGCTGGTAATTTCTATAGAGATGTAGACATAACTTGGGGCGAAGGACGCGGTAAAATACAAGAAGGCGGTAGAGGCCTTGCCCTATCGC
TTGATAAACTTTCTGGCTCTGGCTTTCAATCCAAAAATGAGTACCTTTTTGGAAGATTCGATATGCAACTTAAACTCGTCCCTAAAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291904] SGN-U577928 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104157 [Download][View] Facility Assigned ID: TMEBB76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0031 Quality Trim Threshold: 20.5