Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-C85371

Search information 
Request: 85371Match: SGN-C85371
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C85371Clone name: cLET-39-C19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182166 is on microarray TOM1: SGN-S1-1-5.2.10.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182166 [TUS-38-N20] Trace: SGN-T187807 EST: SGN-E374537 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296574Length: 553 bp (928 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E296574 [] (trimmed) GGGTAATCCTGCAGATGTTGGGAAGATTTTAGAGGGTGAAGTCTTTACCATTGTTGTCCAAAACAGCATCAAATGTGAGAGTGAGAGTAAAAGCA
AGAGCGAAAGCGAAGATGGTGAAATTGATGATTCTGATGCTAGTAAGAAGCAAAAGAGTGCTTTGAAGAGTAAGAGAAAGAAGGAAGGGGATAGT
GACATACCAGAGAAGAGCTTGGAGTTGAGTGATGACGCTGGAATTAATGAGACGAAGGCTGATGAAGCAATGATAGATGAAGTTAATGGTGAGGT
GCTTGAATTTAAAGAACTGATTGAGGCAAGGAAGAGGAGTAATTTTGAAGATGAGGCCCCAGTTGGTCCAATGCCCTTGCCAAGGGCTGAAGGAC
ATATCAGCTATGGTGGGGCACTTAAGCCTGGTGAAGGTGATGCTATTGCCCAATATGTTCAGCAAGGGAAGCGTATTCCACGTAGAGGTGAAGTG
GGTCTTTCTGCTGACGAGATTTCGAAATTCGAGGGTCTTGGCTATGTGATGAGTGGTAGTAGGCATCAAAAGATGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296574] SGN-U576812 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T110100 [Download][View] Facility Assigned ID: TMEFW22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5