EST details — SGN-C84120

Search information 
Request: 84120Match: SGN-C84120
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C84120Clone name: cLET-27-I24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184732 is on microarray TOM1: SGN-S1-1-7.1.14.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184732 [TUS-45-I18] Trace: SGN-T200032 EST: SGN-E398706 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295999Length: 211 bp (737 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295999 [] (trimmed) TGCTTATGAACGCACGCAACGAGTTTATAATGGTAAACCTGATCCTTGTGGTGCTGTCCACATAACAATTGGTGATGGAGGAAACAAAGAAGGTT
TAGCGCGCAAGTACAAGCTACCCCAACCAGAATGGTCTGTGTTCCGCGAAGCAAGCTTTGGCCATGGTGAACTTGCGATAATTAATTCAACTCAT
GCCTCTTGGAGCTGGCATAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295999] SGN-U572285 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T109206 [Download][View] Facility Assigned ID: TMEEB60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0502 Quality Trim Threshold: 12.5