Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C82276

Search information 
Request: 82276Match: SGN-C82276
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82276Clone name: cLET-1-H15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179460 is on microarray TOM1: SGN-S1-1-7.2.2.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179460 [TUS-31-N2] Trace: SGN-T185680 EST: SGN-E373542 Direction: 3' Facility: INRA
Clone: SGN-C179460 [TUS-31-N2] Trace: SGN-T185681 EST: SGN-E373543 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292198Length: 299 bp (893 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292198 [] (trimmed) CACTTGGTGAGGGCCTTGACAAGATCTACCCAGGAGGTGCCTTTGACCCACTTGGCCTTGCTGATGATCCTGAGGCTTTTGCTGAATTGAAGGTG
AAGGAAATTAAGAATGGACGTTTAGCTATGTTTTCTATGTTTGGATTCTTTGTTCAAGCTATTGTTACTGGAAAGGGTCCAATTGATAACCTCTC
TGACCACATTAACGACCCTGTGGCTAACAACGCTTGGGCTTACGCCACAAACTTTGTACCCGGAAAGTGAAAGTAATTTGGGCTAATTAATGAAA
GTTTTATGCTTGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292198] SGN-U579113 Tomato 200607 Build 2 269 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102472 [Download][View] Facility Assigned ID: TMEAC44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0018 Quality Trim Threshold: 12.5